CTF
[Misc] normal_calculate
[Misc] normal_calculate
2020.01.11이 글은 보호되어 있기 때문에 이것을 보려면 암호가 필요합니다.
[Misc] easy_caculate
[Misc] easy_caculate
2020.01.11이 글은 보호되어 있기 때문에 이것을 보려면 암호가 필요합니다.
[Crypto] prob1
[Crypto] prob1
2020.01.11이 글은 보호되어 있기 때문에 이것을 보려면 암호가 필요합니다.
[Cryptography] RSA3
[Cryptography] RSA3
2020.01.11n = 1028368183919327612609718944943180446976194009529547188839823444747945496628476390294025726227089621860288559184921932929541605419723432688177974726350198246510295750856370543263395065136049296315137438761907065670455497199264902285828668624447745851821981134394020801692293757064321632911442759600838060761309348177789426158422776514969974364573431738334820199774855665674921103595171075936365..
[Cryptography] RSA2
[Cryptography] RSA2
2020.01.11n = 675517326695494061190287679557796696358902817969424171685361 c = 0xe3712876ea77c308083ef596a32c5ce2d7edf22abbc58657e 도움 : https://www.alpertron.com.ar/ECM.HTM p = 804811499343607200702893651293 q = 839348502408870119614692320677 phi = 21 666250 324845 688377 538645 829331 393191 999621 542715 910095 508724 from Crypto.Util.number import * n = 6755173266954940611902876795577966963589028179694..
[Cryptography] DNA
[Cryptography] DNA
2020.01.11위 표를 참고해서 대칭일테니 앞부분 GTCATAATGCCGGGACTTGGT 이건 HackCTF이고 뒷부분은 적당히 찾아 플래그를 얻으면 된다… 라고 생각했는데 아니더라 ㅎㅎ; 추출 : TmowOFR{e0_saap_PZ4} 도움 : https://www.dcode.fr/affine-cipher 추출한 문자 위 사이트로 돌리면 뚝딱나옴. FLAG : HackCTF{s0_good_DN4}
[Cryptography] Classic Cipher -4
[Cryptography] Classic Cipher -4
2020.01.11특수문자 종류를 보면 알파벳 종류와 같기 때문에 아무 특수문자 하나를 알파벳으로 교체한 뒤, 도움 : https://quipqiup.com/ 위 사이트를 통해 플래그를 얻으면 된다. in cryptography, a substitution cipher is a method of encrypting by which units of plaintext are replaced with ciphertext, according to a fixed system; the "units" may be single letters (the most common), pairs of letters, triplets of letters, mixtures of the above, and so forth. the receiver de..
[Cryptography] Classic Cipher -3
[Cryptography] Classic Cipher -3
2020.01.11도움 : https://www.dcode.fr/affine-cipher 위 사이트에서 암호문과 키를 넣고 돌리면 플래그 나옴. FLAG : HackCTF{Cl4ss1c_C1pher_1s_very_e4sy_1f91qaf14f}
[Cryptography] Classic Cipher -2
[Cryptography] Classic Cipher -2
2020.01.11도움 : https://www.dcode.fr/transposition-cipher 위 사이트에서 암호문과 키를 넣고 돌리면 플래그 나옴. FLAG = HackCTF{C1pher_1s_very_1n7eres71n5_123}
[Forensics] Magic PNG
[Forensics] Magic PNG
2020.01.11파일을 받아보면 PNG 파일 헤더가 깨져 이미지가 보이지 않는다. 뭐 하나하나 정상 PNG 헤더를 보면서 복구하면 되는데 우리는 시간이 많이 없으므로 복구 사이트를 통해서 돌리면 쉽게 플래그를 얻을 수 있다. 도움 : https://online.officerecovery.com/pixrecovery/ FLAG : HackCTF{c@n_y0u_$ee_m3?}
[Forensics] 잔상
[Forensics] 잔상
2020.01.112개 이미지를 받고 비교해서 플래그를 얻는 문제이다. 간단하게 HxD을 이용해서 비교해보면, 한글자씩 다른 문자가 있고 다 추출하면 48 61 63 6B 43 54 46 7B 77 68 33 72 33 5F 40 72 65 5F 79 6F 75 5F 6C 30 30 6B 69 6E 67 3F 7D FLAG : HackCTF{wh3r3_@re_you_l00king?}
[Hardware] AVR Programming (2)
[Hardware] AVR Programming (2)
2020.01.11이것도 구글링하면서 찾아보다가 도움 사이트 : https://www.avrfreaks.net/forum/how-use-16bit-spi 위 사이트와 이미지를 참고하며 적당히 대입하니 플래그가 완성된다.