CTF/HackCTF
[Pwnable] x64 Simple_size_BOF
[Pwnable] x64 Simple_size_BOF
2020.02.03이 글은 보호되어 있기 때문에 이것을 보려면 암호가 필요합니다.
[Pwnable] Simple_Overflow_ver_2
[Pwnable] Simple_Overflow_ver_2
2020.02.03이 글은 보호되어 있기 때문에 이것을 보려면 암호가 필요합니다.
[Pwnable] Offset
[Pwnable] Offset
2020.02.03이 글은 보호되어 있기 때문에 이것을 보려면 암호가 필요합니다.
[Pwnable] Basic_FSB
[Pwnable] Basic_FSB
2020.02.03이 글은 보호되어 있기 때문에 이것을 보려면 암호가 필요합니다.
[Cryptography] XOR
[Cryptography] XOR
2020.02.03이 글은 보호되어 있기 때문에 이것을 보려면 암호가 필요합니다.
[Cryptography] RSA3
[Cryptography] RSA3
2020.01.11n = 1028368183919327612609718944943180446976194009529547188839823444747945496628476390294025726227089621860288559184921932929541605419723432688177974726350198246510295750856370543263395065136049296315137438761907065670455497199264902285828668624447745851821981134394020801692293757064321632911442759600838060761309348177789426158422776514969974364573431738334820199774855665674921103595171075936365..
[Cryptography] RSA2
[Cryptography] RSA2
2020.01.11n = 675517326695494061190287679557796696358902817969424171685361 c = 0xe3712876ea77c308083ef596a32c5ce2d7edf22abbc58657e 도움 : https://www.alpertron.com.ar/ECM.HTM p = 804811499343607200702893651293 q = 839348502408870119614692320677 phi = 21 666250 324845 688377 538645 829331 393191 999621 542715 910095 508724 from Crypto.Util.number import * n = 6755173266954940611902876795577966963589028179694..
[Cryptography] DNA
[Cryptography] DNA
2020.01.11위 표를 참고해서 대칭일테니 앞부분 GTCATAATGCCGGGACTTGGT 이건 HackCTF이고 뒷부분은 적당히 찾아 플래그를 얻으면 된다… 라고 생각했는데 아니더라 ㅎㅎ; 추출 : TmowOFR{e0_saap_PZ4} 도움 : https://www.dcode.fr/affine-cipher 추출한 문자 위 사이트로 돌리면 뚝딱나옴. FLAG : HackCTF{s0_good_DN4}
[Cryptography] Classic Cipher -4
[Cryptography] Classic Cipher -4
2020.01.11특수문자 종류를 보면 알파벳 종류와 같기 때문에 아무 특수문자 하나를 알파벳으로 교체한 뒤, 도움 : https://quipqiup.com/ 위 사이트를 통해 플래그를 얻으면 된다. in cryptography, a substitution cipher is a method of encrypting by which units of plaintext are replaced with ciphertext, according to a fixed system; the "units" may be single letters (the most common), pairs of letters, triplets of letters, mixtures of the above, and so forth. the receiver de..
[Cryptography] Classic Cipher -3
[Cryptography] Classic Cipher -3
2020.01.11도움 : https://www.dcode.fr/affine-cipher 위 사이트에서 암호문과 키를 넣고 돌리면 플래그 나옴. FLAG : HackCTF{Cl4ss1c_C1pher_1s_very_e4sy_1f91qaf14f}
[Cryptography] Classic Cipher -2
[Cryptography] Classic Cipher -2
2020.01.11도움 : https://www.dcode.fr/transposition-cipher 위 사이트에서 암호문과 키를 넣고 돌리면 플래그 나옴. FLAG = HackCTF{C1pher_1s_very_1n7eres71n5_123}
[Forensics] Magic PNG
[Forensics] Magic PNG
2020.01.11파일을 받아보면 PNG 파일 헤더가 깨져 이미지가 보이지 않는다. 뭐 하나하나 정상 PNG 헤더를 보면서 복구하면 되는데 우리는 시간이 많이 없으므로 복구 사이트를 통해서 돌리면 쉽게 플래그를 얻을 수 있다. 도움 : https://online.officerecovery.com/pixrecovery/ FLAG : HackCTF{c@n_y0u_$ee_m3?}