<DNA CODE>

 

 

 

표를 참고해서 대칭일테니 앞부분 GTCATAATGCCGGGACTTGGT 이건 HackCTF이고 뒷부분은 적당히 찾아 플래그를 얻으면 된다

 

라고 생각했는데 아니더라 ㅎㅎ;

 

추출 : TmowOFR{e0_saap_PZ4}

 

도움 : https://www.dcode.fr/affine-cipher

 

추출한 문자 사이트로 돌리면 뚝딱나옴.

 

 

FLAG : HackCTF{s0_good_DN4}

'CTF > HackCTF' 카테고리의 다른 글

[Cryptography] RSA3  (0) 2020.01.11
[Cryptography] RSA2  (0) 2020.01.11
[Cryptography] DNA  (0) 2020.01.11
[Cryptography] Classic Cipher -4  (0) 2020.01.11
[Cryptography] Classic Cipher -3  (0) 2020.01.11
[Cryptography] Classic Cipher -2  (0) 2020.01.11